adrb3a

Ensembl ID:
ENSDARG00000053646
ZFIN ID:
ZDB-GENE-080917-21
Description:
beta-3 adrenergic receptor [Source:RefSeq peptide;Acc:NP_001121807]
Human Orthologue:
ADRB3
Human Description:
adrenergic, beta-3-, receptor [Source:HGNC Symbol;Acc:288]
Mouse Orthologue:
Adrb3
Mouse Description:
adrenergic receptor, beta 3 Gene [Source:MGI Symbol;Acc:MGI:87939]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21349 Nonsense Available for shipment Available now
sa7147 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075713 Nonsense 23 446 1 2
ENSDART00000127633   None 413 None 2
Genomic Location (Zv9):
Chromosome 8 (position 38812307)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37667722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACATGGAAAACATGACAAACATGACAAACAACACTCAGAATGTGACA[C/T]AGAATGAAGGGTTCAAGTCACTGCTATTCGTCATGGTGATCATCATCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075713 Essential Splice Site 438 446 None 2
ENSDART00000127633 Essential Splice Site 405 413 None 2
Genomic Location (Zv9):
Chromosome 8 (position 38813555)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37668970
KASP Assay ID:
554-5292.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMAACGGCAGCACCTTCTTCAGTGAAMTCTCTGAACCTGAGACAGAATTG[T/A]GAGTCACATTCTTTACTTCTGTKCTTTCAGGTGTAAGAAKWGTTGCNNAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link