adrb3a

Ensembl ID:
ENSDARG00000053646
ZFIN ID:
ZDB-GENE-080917-21
Description:
beta-3 adrenergic receptor [Source:RefSeq peptide;Acc:NP_001121807]
Human Orthologue:
ADRB3
Human Description:
adrenergic, beta-3-, receptor [Source:HGNC Symbol;Acc:288]
Mouse Orthologue:
Adrb3
Mouse Description:
adrenergic receptor, beta 3 Gene [Source:MGI Symbol;Acc:MGI:87939]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21349 Nonsense Mutation detected in F1 DNA During 2014
sa5495 Nonsense Mutation detected in F1 DNA During 2014
sa7147 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075713 Nonsense 23 446 1 2
ENSDART00000127633 None None 413 None 2
Genomic Location:
Chromosome 8 (position 38812307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACATGGAAAACATGACAAACATGACAAACAACACTCAGAATGTGACA[C/T]AGAATGAAGGGTTCAAGTCACTGCTATTCGTCATGGTGATCATCATCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075713 Nonsense 187 446 1 2
ENSDART00000127633 Nonsense 154 413 1 2
Genomic Location:
Chromosome 8 (position 38812801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCCTAATGATGATGTAGCAACTGCATGTTATAGTGATACAAACTGCTG[T/A]GATTTYATAACAAACATGACCTATGCCATCATTTCATCAGTGGTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075713 Essential Splice Site 438 446 None 2
ENSDART00000127633 Essential Splice Site 405 413 None 2
Genomic Location:
Chromosome 8 (position 38813555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMAACGGCAGCACCTTCTTCAGTGAAMTCTCTGAACCTGAGACAGAATTG[T/A]GAGTCACATTCTTTACTTCTGTKCTTTCAGGTGTAAGAAKWGTTGCNNAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/70o20w6u