efcab4a

Ensembl ID:
ENSDARG00000053636
ZFIN ID:
ZDB-GENE-061215-136
Description:
EF-hand calcium-binding domain-containing protein 4A [Source:UniProtKB/Swiss-Prot;Acc:A1A600]
Human Orthologue:
EFCAB4A
Human Description:
EF-hand calcium binding domain 4A [Source:HGNC Symbol;Acc:28703]
Mouse Orthologue:
Efcab4a
Mouse Description:
EF-hand calcium binding domain 4A Gene [Source:MGI Symbol;Acc:MGI:2446129]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37989 Nonsense Mutation detected in F1 DNA During 2016
sa44218 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6790 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075663 Nonsense 22 408 2 10
Genomic Location:
Chromosome 25 (position 3912586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGACGGGGTGGTGCTGGAGGGGACGGGCAGCGGTCAGATGTCCCCC[A/T]GATCCACACTGCGGAGCCCATTGCCCAGTCGCACAGCGAGGTCATCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075663 Essential Splice Site 160 408 5 10
Genomic Location:
Chromosome 25 (position 3907830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCCAATGATAGTGATTTGTTTGTTGGTCATGTGTCTTCGTTTGTCA[G/A]TCAGTGGGAGTTGTGTGGTCTGTGGTGTGAGCTGCAGAGGGACAAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075663 Essential Splice Site 358 408 9 10
Genomic Location:
Chromosome 25 (position 3903300)
KASP Assay ID:
554-5288.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCAGAAGGAGCGGGAAAGCCTYGTSAGACAGYTGGAGCTGCTCCGG[T/C]AAGTTTGACCAGACTAACCKGATCACAYCTTGAGTTTATAACAGGATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link