itln4

Ensembl ID:
ENSDARG00000053630
ZFIN ID:
ZDB-GENE-090527-5
Human Orthologues:
ITLN1, ITLN2
Human Descriptions:
intelectin 1 (galactofuranose binding) [Source:HGNC Symbol;Acc:18259]
intelectin 2 [Source:HGNC Symbol;Acc:20599]
Mouse Orthologues:
Gm9765, Itln1
Mouse Descriptions:
intelectin 1 (galactofuranose binding) Gene [Source:MGI Symbol;Acc:MGI:1333831]
predicted gene 9765 Gene [Source:MGI Symbol;Acc:MGI:3642721]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1672 Essential Splice Site Available for shipment Available now
sa25365 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076172 Essential Splice Site 152 329 4 7
Genomic Location:
Chromosome 7 (position 30850663)
KASP Assay ID:
554-1618.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGAAAAAATATATACTTCAGATGTTTAGATGTTTCATTTCTGTCACA[G/T]AATCCTGGATACTTTGACATTCCGGCTCAGGATGTGTCKGTGTGGCACGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076172 Essential Splice Site 204 329 4 7
Genomic Location:
Chromosome 7 (position 30850823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATCGCTTCCTAACCCTACATGGAGGAAACCTTTTCAATTTATTCAAG[G/A]TCAGATTCACTTTAGATGCCAGTTCTGGAGTTTGATACATTCACAAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/115bwgks