anxa2b

Ensembl ID:
ENSDARG00000053625
ZFIN ID:
ZDB-GENE-030131-1089
Description:
annexin A2b [Source:RefSeq peptide;Acc:NP_001099070]
Human Orthologue:
ANXA2
Human Description:
annexin A2 [Source:HGNC Symbol;Acc:537]
Mouse Orthologue:
Anxa2
Mouse Description:
annexin A2 Gene [Source:MGI Symbol;Acc:MGI:88246]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20962 Nonsense Available for shipment Available now
sa30887 Nonsense Mutation detected in F1 DNA During 2016
sa40910 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 67 338 3 12
ENSDART00000124028 Nonsense 67 338 4 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30868230)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29260572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACGAGCAGACAATCATTGACATTCTGACAAGACGCAGTTACTTACAA[A/T]GAAACGATATTGCATTTGAGTATGAAAAGCGAGCAAAGAAGGTACAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30866521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29258863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGGTGTTCATTCATCTACTTGTTTTTCCCAGTGTTTAAGAAGGACT[T/A]GGAGAAAGATATTTCTGGAGACACATCTGGAGATTTTGCGAAGCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30866521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29258863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGGTGTTCATTCATCTACTTGTTTTTCCCAGTGTTTAAGAAGGACT[T/A]GGAGAAAGATATTTCTGGAGACACATCTGGAGATTTTGCGAAGCTGCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link