anxa2b

Ensembl ID:
ENSDARG00000053625
ZFIN ID:
ZDB-GENE-030131-1089
Description:
annexin A2b [Source:RefSeq peptide;Acc:NP_001099070]
Human Orthologue:
ANXA2
Human Description:
annexin A2 [Source:HGNC Symbol;Acc:537]
Mouse Orthologue:
Anxa2
Mouse Description:
annexin A2 Gene [Source:MGI Symbol;Acc:MGI:88246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20962 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 67 338 3 12
ENSDART00000124028 Nonsense 67 338 4 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 30868230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACGAGCAGACAATCATTGACATTCTGACAAGACGCAGTTACTTACAA[A/T]GAAACGATATTGCATTTGAGTATGAAAAGCGAGCAAAGAAGGTACAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/efup0bbb