csf1rb

Ensembl ID:
ENSDARG00000053624
ZFIN ID:
ZDB-GENE-091118-1
Human Orthologue:
CSF1R
Human Description:
colony stimulating factor 1 receptor [Source:HGNC Symbol;Acc:2433]
Mouse Orthologue:
Csf1r
Mouse Description:
colony stimulating factor 1 receptor Gene [Source:MGI Symbol;Acc:MGI:1339758]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24034 Nonsense Mutation detected in F1 DNA During 2014
sa1503 Essential Splice Site Available for shipment Available now
sa4155 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4970 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24035 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Nonsense 382 851 9 23
ENSDART00000142718 Nonsense 466 964 9 21
Genomic Location:
Chromosome 21 (position 42271026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACCGTACATCAGGTGTGGAATTAATGGCCAACCAATCCATTTCTGAG[C/T]AAAGCGGAGAGTATGAACCAGTGCTGGTGAAGAGTGCATTACCAGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 507 851 12 23
ENSDART00000142718 Essential Splice Site 590 964 11 21
Genomic Location:
Chromosome 21 (position 42273132)
KASP Assay ID:
554-1428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCCATACAACAAGAAACTGGAGTTTCCTCGAAATAAGCTGAAGCTTG[G/A]TACTTACACTCTCTGTTTTACTAGAGTATAATTTTGTAATGATAAGAAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa4155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 666 851 None 23
ENSDART00000142718 None 732 964 15 21
Genomic Location:
Chromosome 21 (position 42278156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGGAATGCTTACTCTGGTTTAGACAGCTTTAGGGACACACCRTCAGG[A/G]CAGATGCCAAAAGAGCCTTTTCAGGGTAAAGTAATATAGTACGCCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 697 851 20 23
ENSDART00000142718 Essential Splice Site 777 964 17 21
Genomic Location:
Chromosome 21 (position 42279432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTTTRATTATATACCWCCCTCTGTAWTTATAAGACTRTCTGTTATC[A/G]GTGTATTCACAGAGATTTGGCAGCACGGAAYGTTCTAGTGGCTGACTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Nonsense 755 851 21 23
ENSDART00000142718 Nonsense 835 964 18 21
Genomic Location:
Chromosome 21 (position 42280817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGCCAGTGAAATGGATGTCACCTGAAAGCATTTTTGAATGTCTGTA[C/A]ACAGTCCAAAGTGATGTCTGGTCATATGGTGTCCTTTTATGGGAGATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lt3yosgl