csf1rb

Ensembl ID:
ENSDARG00000053624
ZFIN ID:
ZDB-GENE-091118-1
Human Orthologue:
CSF1R
Human Description:
colony stimulating factor 1 receptor [Source:HGNC Symbol;Acc:2433]
Mouse Orthologue:
Csf1r
Mouse Description:
colony stimulating factor 1 receptor Gene [Source:MGI Symbol;Acc:MGI:1339758]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37380 Nonsense Mutation detected in F1 DNA During 2016
sa24034 Nonsense Available for shipment Available now
sa1503 Essential Splice Site Available for shipment Available now
sa43722 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29665 Essential Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa32360 Essential Splice Site Available for shipment Available now
sa24035 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Nonsense 369 851 9 23
ENSDART00000142718 Nonsense 453 964 9 21
Genomic Location (Zv9):
Chromosome 21 (position 42270988)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43870034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCTAATTGCTTTTGATTTGATGGCAGGTGTAGTGACAACCGTACAT[C/A]AGGTGTGGAATTAATGGCCAACCAATCCATTTCTGAGCAAAGCGGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Nonsense 382 851 9 23
ENSDART00000142718 Nonsense 466 964 9 21
Genomic Location (Zv9):
Chromosome 21 (position 42271026)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43870072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACCGTACATCAGGTGTGGAATTAATGGCCAACCAATCCATTTCTGAG[C/T]AAAGCGGAGAGTATGAACCAGTGCTGGTGAAGAGTGCATTACCAGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 507 851 12 23
ENSDART00000142718 Essential Splice Site 590 964 11 21
Genomic Location (Zv9):
Chromosome 21 (position 42273132)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43872178
KASP Assay ID:
554-1428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCCATACAACAAGAAACTGGAGTTTCCTCGAAATAAGCTGAAGCTTG[G/A]TACTTACACTCTCTGTTTTACTAGAGTATAATTTTGTAATGATAAGAAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 580 851 14 23
ENSDART00000142718 Essential Splice Site 663 964 13 21
Genomic Location (Zv9):
Chromosome 21 (position 42275102)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43874148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCACATGAAAACATAGTCAATCTGCTGGGGGCATGCACTCAGGGCGG[T/A]AAGTCAAAGTTGTATTTCTACATTGTAGAGATGGATAAAAAAAGGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 666 851 19 23
ENSDART00000142718 Nonsense 746 964 16 21
Genomic Location (Zv9):
Chromosome 21 (position 42278278)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43877324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTCATTATGCTAATATCTGACTTTTTCAACAGAGTCCTGTAATGAA[G/T]AATTGGAGAACATGCTGTCATTGGATAACATGGATTTGCTTATGTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Essential Splice Site 738 851 21 23
ENSDART00000142718 Essential Splice Site 818 964 18 21
Genomic Location (Zv9):
Chromosome 21 (position 42280762)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43879808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCTGTCTACTATGAAATTTCTTTACATGCTGTTGCTTTGGTTTTAT[A/G]GGCACGGCTGCCAGTGAAATGGATGTCACCTGAAAGCATTTTTGAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075675 Nonsense 755 851 21 23
ENSDART00000142718 Nonsense 835 964 18 21
Genomic Location (Zv9):
Chromosome 21 (position 42280817)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43879863
KASP Assay ID:
2261-6100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGCCAGTGAAATGGATGTCACCTGAAAGCATTTTTGAATGTCTGTA[C/A]ACAGTCCAAAGTGATGTCTGGTCATATGGTGTCCTTTTATGGGAGATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link