prdm1b

Ensembl ID:
ENSDARG00000053592
ZFIN ID:
ZDB-GENE-080618-2
Description:
PR domain containing 1b [Source:UniProtKB/TrEMBL;Acc:A5XCE7]
Human Orthologue:
PRDM1
Human Description:
PR domain containing 1, with ZNF domain [Source:HGNC Symbol;Acc:9346]
Mouse Orthologue:
Prdm1
Mouse Description:
PR domain containing 1, with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:99655]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23609 Nonsense Available for shipment Available now
sa43356 Nonsense Mutation detected in F1 DNA During 2017
sa12402 Nonsense Available for shipment Available now
sa18430 Nonsense Available for shipment Available now
sa7302 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 24 377 2 3
Genomic Location (Zv9):
Chromosome 19 (position 50152156)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48516996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCAGTTGCAGCACTTCATTGACGGTTATGATGTCCGGCTCAGCAACTG[G/A]ATGCGTTACGTTAACCCGGCGCGCTCGCTGGCCGAACAGAACCTGGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 107 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50144591)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48524561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATATGGAGTACCAGAAGCCTCCTCTACCTCAGTACACATATTACCCC[A/T]AACACCCCTCGAACCCACAAAACCATCCCTGCGACACAAATAAAGACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 199 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50144313)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48524839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCACCGAGAGGGTTTGATCTCCTCATATCCGTCAATACGGTCTCCATA[T/A]CCGCTCTTACCGCAGTATAACCCTCATTACCARCACATGCTCATTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 346 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50143872)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48525280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCACTGAARAAGCAGAACGGGAAGATCAAMTATGAATGCAATGTCTG[T/A]ATGAAGACTTTCGGACAGCTCTCCAATCTTAAAGTGAGTACAATGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 372 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50143795)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48525357
KASP Assay ID:
554-4758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTAAAGTGAGTACAATGTGTGTGTTTAAATGTGTTATATCACCTATTT[T/A]AAAAGTGAAGNNNATATACTAAAGGTTAACTCTGTATTTATCTTGCTGAAGGY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Systemic lupus erythematosus: Genome-wide association study in a Chinese Han population identifies nine new susceptibility loci for systemic lupus erythematosus. (View Study)
  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link