lass6

Ensembl ID:
ENSDARG00000053583
ZFIN ID:
ZDB-GENE-070522-1
Description:
Novel protein similar to LAG1 homolog, ceramide synthase family (S. cerevisiae) [Source:UniProtKB/Tr
Human Orthologue:
LASS6
Human Description:
LAG1 homolog, ceramide synthase 6 [Source:HGNC Symbol;Acc:23826]
Mouse Orthologue:
Lass6
Mouse Description:
LAG1 homolog, ceramide synthase 6 Gene [Source:MGI Symbol;Acc:MGI:2442564]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075627 Nonsense 312 392 9 10
ENSDART00000140785 Nonsense 130 211 4 5
Genomic Location:
Chromosome 9 (position 49927215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACAGTGTTYGAGAGCTGGGAGATCRTAGGCCCGTACCCGTCCTGGTG[G/A]CTCTTTAACGGACTGCTCGTYCTTCTTCAGGCGCTGCACACCTTCTGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wshemcw7