fancd2

Ensembl ID:
ENSDARG00000053574
ZFIN ID:
ZDB-GENE-040116-5
Description:
hypothetical protein LOC402960 [Source:RefSeq peptide;Acc:NP_991224]
Human Orthologue:
FANCD2
Human Description:
Fanconi anemia, complementation group D2 [Source:HGNC Symbol;Acc:3585]
Mouse Orthologue:
Fancd2
Mouse Description:
Fanconi anemia, complementation group D2 Gene [Source:MGI Symbol;Acc:MGI:2448480]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20790 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20789 Essential Splice Site Available for shipment Available now
sa20788 Nonsense Mutation detected in F1 DNA During 2014
sa9077 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5381 Nonsense Mutation detected in F1 DNA During 2014
sa7045 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3612 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18469 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 552 1445 18 45
ENSDART00000125089 Essential Splice Site 552 1659 17 45
ENSDART00000128777 Essential Splice Site 552 1445 18 44
Genomic Location:
Chromosome 6 (position 42256088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCAGTCGCCTGGCATTCGGACAGGAGCAGCATGGAGGACACATCCAG[G/A]TAAGAAACGCTTCTTTTGAAATACATAGTATACAATGTCTTTTAAATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 864 1445 27 45
ENSDART00000125089 Essential Splice Site 864 1659 26 45
ENSDART00000128777 Essential Splice Site 864 1445 27 44
Genomic Location:
Chromosome 6 (position 42248560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGATACCATCTTCTTCAGTCGTTCAACAAAAGAAAGGAAAGAAAGG[T/C]AAGGTTGCTGGGGAAATGACCAAACTTGAATTCTGTTGGTGTTTAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Nonsense 893 1445 28 45
ENSDART00000125089 Nonsense 893 1659 27 45
ENSDART00000128777 Nonsense 893 1445 28 44
Genomic Location:
Chromosome 6 (position 42247941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTCCTCTGGTGACAAGTCACAGCTAGAGGGAGCAGCAGATGCAGAA[G/T]AGTCCCAACCGGTAAAAACCCCATATATTGTCTCTACTTTTATTTACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 991 1445 30 45
ENSDART00000125089 Essential Splice Site 991 1659 29 45
ENSDART00000128777 Essential Splice Site 991 1445 30 44
Genomic Location:
Chromosome 6 (position 42246696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACTTCAGTTTAACTTCCGCTCCAGCCAAAAAGGCTCCATTTCTCAAA[G/A]TATGAACACAAACACTGCGTAAATAATTGRCCTACTGTAAAYKAATTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Nonsense 1133 1445 34 45
ENSDART00000125089 Nonsense 1133 1659 33 45
ENSDART00000128777 Nonsense 1133 1445 34 44
Genomic Location:
Chromosome 6 (position 42234369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAGAACTTCCGAAGCACYGTRCCCAGTCTGAACACAGCCCTGTGCT[T/A]GACACAGCTGCTCATTGTGTTGTCTCAGTATGGGGGATCAAACCACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 1189 1445 36 45
ENSDART00000125089 Essential Splice Site 1189 1659 35 45
ENSDART00000128777 Essential Splice Site 1189 1445 36 44
Genomic Location:
Chromosome 6 (position 42231220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAAATATYTCTGAGGATGTTTTTCTGTAATGTTGTTTTTCTGCTGTA[G/A]TATTTATCTGGAGCACACAGATGATGTTCTGAAGGCRGTGGAGGAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 1323 1445 40 45
ENSDART00000125089 Essential Splice Site 1323 1659 39 45
ENSDART00000128777 Essential Splice Site 1323 1445 40 44
Genomic Location:
Chromosome 6 (position 42230392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAAGCTTGGAATGCCTCTGCTTGACTACAGCTTTAAAAAACACAAGG[T/C]ATTTGTGTTACGTTCATTTTACAGGGTATCTGCGGGCTCTGAAATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Nonsense 1407 1445 43 45
ENSDART00000125089 Nonsense 1407 1659 42 45
ENSDART00000128777 Nonsense 1407 1445 43 44
Genomic Location:
Chromosome 6 (position 42224274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTTTGTTTTGTTTTTGCAGGGTGAAGAGATTCTCTCTCAGAGGTCA[C/T]AGGCAGCTGATGAAGAGGAGGAAGAGTCCTCTCAGCTACAGAGCGAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bv3xe64q