pr2y4l

Ensembl ID:
ENSDARG00000053570
ZFIN ID:
ZDB-GENE-030616-77
Description:
pyrimidinergic receptor P2Y, G-protein coupled, 4-like [Source:RefSeq peptide;Acc:NP_001004501]
Human Orthologue:
P2RY4
Human Description:
pyrimidinergic receptor P2Y, G-protein coupled, 4 [Source:HGNC Symbol;Acc:8542]
Mouse Orthologue:
P2ry4
Mouse Description:
pyrimidinergic receptor P2Y, G-protein coupled, 4 Gene [Source:MGI Symbol;Acc:MGI:1926594]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7394 Missense Mutation detected in F1 DNA During 2017
sa42415 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045018 Missense 37 341 1 1
Genomic Location (Zv9):
Chromosome 14 (position 33661510)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32443143
KASP Assay ID:
554-4174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGYGAACTTCAGCTGTACTTTCGATGAGGAGTTCAAGTATATTCTTC[T/A]GCCCGTKTCATATTCCCTGGTGTGTTTCTTCGGACTAATCCTTAACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045018 Nonsense 238 341 1 1
Genomic Location (Zv9):
Chromosome 14 (position 33662112)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32442541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGGCACGGGCCCTTTGCCAACCCCGAAAGGGCCTGGCCCAAAATCAA[C/T]AAAGTTCATCCCGGAAGAAGTCCATTAAACTCATCATAGTGGTATTGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link