pstpip1b

Ensembl ID:
ENSDARG00000053568
ZFIN ID:
ZDB-GENE-051127-25
Description:
proline-serine-threonine phosphatase interacting protein 1b [Source:RefSeq peptide;Acc:NP_001032668
Human Orthologue:
PSTPIP1
Human Description:
proline-serine-threonine phosphatase interacting protein 1 [Source:HGNC Symbol;Acc:9580]
Mouse Orthologue:
Pstpip1
Mouse Description:
proline-serine-threonine phosphatase-interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1321396]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20970 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075609 Essential Splice Site 12 379 None 15
ENSDART00000142033 Essential Splice Site 44 174 None 8
Genomic Location (Zv9):
Chromosome 7 (position 31390122)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29782464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGGCCGACACATGTGCAAAGATGTAGAAGAACTGCTGAAAATGAGG[T/A]ATGGAATTATTATTTACTGTAGAAATGTGTCTCTGCAAATGTCAGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link