tspan3b

Ensembl ID:
ENSDARG00000053559
ZFIN ID:
ZDB-GENE-070424-42
Description:
tetraspanin 3b [Source:RefSeq peptide;Acc:NP_001076335]
Human Orthologue:
TSPAN3
Human Description:
tetraspanin 3 [Source:HGNC Symbol;Acc:17752]
Mouse Orthologue:
Tspan3
Mouse Description:
tetraspanin 3 Gene [Source:MGI Symbol;Acc:MGI:1928098]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20971 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075600 Nonsense 156 253 5 7
Genomic Location:
Chromosome 7 (position 31416773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTTCACTTTTAGCTTCACTGCTGTGGCATTCATAATTACTCTGACTG[G/A]ATGAACACTCATTGGTTTATCGAGTCCAAAAACAACAGTGTTCCAGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/so7v7b5d