rtkn2

Ensembl ID:
ENSDARG00000053558
ZFIN ID:
ZDB-GENE-041010-225
Description:
Rhotekin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q5XIZ9]
Human Orthologue:
RTKN2
Human Description:
rhotekin 2 [Source:HGNC Symbol;Acc:19364]
Mouse Orthologue:
Rtkn2
Mouse Description:
rhotekin 2 Gene [Source:MGI Symbol;Acc:MGI:2158417]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42988 Nonsense Mutation detected in F1 DNA During 2017
sa32171 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075596 Nonsense 63 641 2 13
ENSDART00000136431 Nonsense 63 641 2 12
Genomic Location (Zv9):
Chromosome 17 (position 43664471)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43629146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATTAAGGAGAAGATGGAGTTTGAGATGCGAATGAGAGCGGGGGCTTA[T/G]AAGCTTATGGTTGCGAGCACTAAAAAGGAGCAGGTCTTGGATGCATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075596 Essential Splice Site 125 641 4 13
ENSDART00000136431 Essential Splice Site 125 641 4 12
Genomic Location (Zv9):
Chromosome 17 (position 43663794)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43628469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAATTTCAGTTTCTTTGGTTCATAATTTTTTTCCTTTTGGCTTATCC[A/T]GGTCTACGTATTCCACTGTTTTGGAAGGATTCAGAGCACTTTAACAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Rheumatoid arthritis: Functional variants in NFKBIE and RTKN2 involved in activation of the NF-κB pathway are associated with rheumatoid arthritis in Japanese. (View Study)
  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)
  • Systolic blood pressure: Genome-wide association study identifies eight loci associated with blood pressure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link