dpf1

Ensembl ID:
ENSDARG00000053548
ZFIN ID:
ZDB-GENE-050913-31
Description:
D4, zinc and double PHD fingers family 1 [Source:RefSeq peptide;Acc:NP_001025375]
Human Orthologue:
DPF1
Human Description:
D4, zinc and double PHD fingers family 1 [Source:HGNC Symbol;Acc:20225]
Mouse Orthologue:
Dpf1
Mouse Description:
D4, zinc and double PHD fingers family 1 Gene [Source:MGI Symbol;Acc:MGI:1352748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1904 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1904
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075587 Nonsense 214 276 8 8
ENSDART00000099148 Nonsense 203 397 7 14
ENSDART00000137411 Nonsense 240 302 8 8
Genomic Location (Zv9):
Chromosome 15 (position 13894024)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14367687
KASP Assay ID:
554-1894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTCTGTTTGTTTCCTTGTGTGTTTCTTTGTGTTCAGTTTGTGGAAAG[C/T]GATACAAGAACCGTCCAGGTTTGAGTTACCATTACACTCACACACACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link