kctd12.2

Ensembl ID:
ENSDARG00000053542
ZFIN ID:
ZDB-GENE-060117-4
Description:
potassium channel tetramerisation domain containing 12.2 [Source:RefSeq peptide;Acc:NP_001029191]
Human Orthologue:
KCTD12
Human Description:
potassium channel tetramerisation domain containing 12 [Source:HGNC Symbol;Acc:14678]
Mouse Orthologue:
Kctd12b
Mouse Description:
potassium channel tetramerisation domain containing 12b Gene [Source:MGI Symbol;Acc:MGI:2444667]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12835 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075584 Nonsense 269 271 1 1
Genomic Location:
Chromosome 1 (position 33929464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCCCAACGAGGACAAAATCTGGACGAGTTACACCGAGTATGTTTTTTG[T/A]AGGGAGTGAAGTACTGTAGTGGACTSACTTGGGAACTGTTATTCAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z4bd784h