lmo7b

Ensembl ID:
ENSDARG00000053535
ZFIN ID:
ZDB-GENE-060825-242
Description:
Novel protein similar to H.sapiens LMO7, LIM domain 7 (LMO7, zgc:152922) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
LMO7
Human Description:
LIM domain 7 [Source:HGNC Symbol;Acc:6646]
Mouse Orthologue:
Lmo7
Mouse Description:
LIM domain only 7 Gene [Source:MGI Symbol;Acc:MGI:1353586]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19525 Essential Splice Site Available for shipment Available now
sa19524 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7909 Nonsense Mutation detected in F1 DNA During 2014
sa16373 Nonsense Available for shipment Available now
sa12998 Nonsense Available for shipment Available now
sa10064 Nonsense Available for shipment Available now
sa10684 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 None None 1188 None 27
ENSDART00000083736 Essential Splice Site None 161 None 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 None None 227 None 8
ENSDART00000143048 None None 822 None 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34083007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTAGCCGCGGGAAGCAAATACACGTAATTGAAAGAAGGGCTTGCAGG[T/A]AAGTTTAGACTTGTTGCATTTGTGTTTTCTTGTGTGGTGGCACAGGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 Essential Splice Site 106 1188 5 27
ENSDART00000083736 Essential Splice Site 106 161 6 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 Essential Splice Site 91 227 5 8
ENSDART00000143048 None None 822 None 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34065500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATCTGTGTCTGTTCATTTCATTTAACCTGCTTCTTTTCTTCTGCTT[A/T]GACGTGAAGAGACAAACAGAAGACTAAAAAATGTAAGTTTTATTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 Nonsense 195 1188 7 27
ENSDART00000083736 None None 161 None 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 Nonsense 180 227 7 8
ENSDART00000143048 None None 822 None 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34059363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAGAGGAGCTGTACAGTGTGAAGCAGCCRAGCTACAGGAGGGAGGATT[C/A]AGTGGAGAGCCTRGACTCAGTGGAGTCTCGYRCACTCAGCGKGGCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 Nonsense 657 1188 13 27
ENSDART00000083736 None None 161 None 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 None None 227 None 8
ENSDART00000143048 Nonsense 291 822 4 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34029447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGGAGAGACTTTGGATTCAAGGCTCACTGGGACTCAGTTGGTGCTTA[T/A]GTKAAATCTGTTCAAGCAGGTAAGACTTAATGGTTKCTGTGAAGTGGTCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 Nonsense 736 1188 15 27
ENSDART00000083736 None None 161 None 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 None None 227 None 8
ENSDART00000143048 Nonsense 370 822 6 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34021807)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGTGGCCAACCTTCCCTACCATACCAGAGCCATAAGATAATCAATT[T/A]GACAAGTGCCACTTCAACACTTATAGGGCGACCTGAGCACTTTRTYCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 Nonsense 1107 1188 24 27
ENSDART00000083736 None None 161 None 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 None None 227 None 8
ENSDART00000143048 Nonsense 741 822 15 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34006970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAACTACWCCTGAACCGMCGGGCCTCGAGTCCCGTCCAAACTCTCAG[C/T]AGCAGGGCAGGTATGGACTATTCATGTGTGRAAGTCATGTYTTTACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075577 Essential Splice Site 1146 1188 25 27
ENSDART00000083736 None None 161 None 8
ENSDART00000135351 None None 178 None 2
ENSDART00000140515 None None 227 None 8
ENSDART00000143048 Essential Splice Site 780 822 16 18

The following transcripts of ENSDARG00000053535 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 34005140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGTCATCGATTCCCTGGAGCTCTGCTTTCACATTGGCTGCTTCAAG[G/A]TGAGGCCGGAGGTCACCTGAAACTGAGAGAACTGGCCATCCATGGACATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b5hhar0s