si:busm1-64d20.2

Ensembl ID:
ENSDARG00000053525
ZFIN ID:
ZDB-GENE-040724-240
Description:
Si:busm1-64d20.2 protein [Source:UniProtKB/TrEMBL;Acc:A8WGC5]
Human Orthologue:
ENPP7
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 7 [Source:HGNC Symbol;Acc:23764]
Mouse Orthologue:
Enpp7
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 7 Gene [Source:MGI Symbol;Acc:MGI:3027917]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42068 Nonsense Mutation detected in F1 DNA During 2017
sa22142 Nonsense Available for shipment Available now
sa35334 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105574 Nonsense 89 488 2 6
Genomic Location (Zv9):
Chromosome 12 (position 34113946)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32311112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGAAATAATTGAATCAATGATCAATTGTTTTCCTCCACAGGAAGGTA[C/A]ATTGAGAACCATGGCGTAATTCACAATGTGTGGTTCAACACAACCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105574 Nonsense 275 488 3 6
Genomic Location (Zv9):
Chromosome 12 (position 34112646)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32309812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACCAAGTCAAAGAAATAGTCCTCACCGACATCCCAGGATTCTCTTAC[A/T]AAGATCTGCAGTTCCACTTGTTGGACTATGGACCGACTGCGATGCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105574 Essential Splice Site 469 488 5 6
Genomic Location (Zv9):
Chromosome 12 (position 34111642)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32308808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTGTCACATCCTACAACGGATATAAAAAGCACAAACTGTATTCAAA[G/A]TAGGGCACAAAGCTACATTAACACATTATTTTTTGGGACAGTTTCTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link