adhfe1

Ensembl ID:
ENSDARG00000053518
ZFIN ID:
ZDB-GENE-040426-2070
Description:
hydroxyacid-oxoacid transhydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_996969]
Human Orthologue:
ADHFE1
Human Description:
alcohol dehydrogenase, iron containing, 1 [Source:HGNC Symbol;Acc:16354]
Mouse Orthologue:
Adhfe1
Mouse Description:
alcohol dehydrogenase, iron containing, 1 Gene [Source:MGI Symbol;Acc:MGI:1923437]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17509 Nonsense Available for shipment Available now
sa19835 Nonsense Mutation detected in F1 DNA During 2014
sa25118 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075551 Nonsense 224 477 8 14
ENSDART00000110177 Nonsense 256 509 9 15
Genomic Location:
Chromosome 2 (position 42205816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTATATTTAGCCCATTGATGTGTRTGTTTTTCAGGCATCGCAAAT[C/T]GAGCCTTAAAACCTACATTGGGAATGGTGGATCCTCTACATACTCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075551 Nonsense 272 477 9 14
ENSDART00000110177 Nonsense 304 509 10 15
Genomic Location:
Chromosome 2 (position 42204115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCATTAGAGTCATTCACAGCATTGCCGTATAACCTGCGTAGCCCCTG[T/A]CCGCCAAACCCCATCAGCCGGCCCGCTTACCAGGGGAGCAATCCAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075551 Essential Splice Site 306 477 9 14
ENSDART00000110177 Essential Splice Site 338 509 10 15
Genomic Location:
Chromosome 2 (position 42204013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTTTGGGCAAAGCACGCTCTCCGGATCGTCGCTAAATACTTGAAACG[G/A]TATGTTTTTGGGATGTGAAAGGATGTGCATTATATGTTTTAGTGAGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e53h4hmh