crybb2

Ensembl ID:
ENSDARG00000053512
ZFIN ID:
ZDB-GENE-060130-1
Description:
beta-crystallin B2 [Source:RefSeq peptide;Acc:NP_001018138]
Human Orthologue:
CRYBB2
Human Description:
crystallin, beta B2 [Source:HGNC Symbol;Acc:2398]
Mouse Orthologue:
Crybb2
Mouse Description:
crystallin, beta B2 Gene [Source:MGI Symbol;Acc:MGI:88519]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34464 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34465 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075553 Essential Splice Site 105 208 4 6
ENSDART00000135525 Essential Splice Site 105 185 3 5

The following transcripts of ENSDARG00000053512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44672868)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42625650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAGCAGACGCAGTGACTGCATCGTCGCCTTCCGCCCCATCAAAGTG[G/T]TAACTAAATACAGTACAGCAGAATTGTGAAAGTGTCACGTGTGTAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075553 Nonsense 142 208 5 6
ENSDART00000135525 Nonsense 142 185 4 5

The following transcripts of ENSDARG00000053512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44674170)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42626952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGATCATAGACGATGACGTTCCCAGCTTCCACGCTCATGGATACCAT[G/T]AGAAAGTCTCTTCAGTTCGTGTGCAGAGTGGCACGTGAGTAAAACCCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link