kazald3

Ensembl ID:
ENSDARG00000053509
ZFIN ID:
ZDB-GENE-050208-155
Description:
kazal-type serine protease inhibitor domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_0011
Human Orthologue:
KAZALD1
Human Description:
Kazal-type serine peptidase inhibitor domain 1 [Source:HGNC Symbol;Acc:25460]
Mouse Orthologue:
Kazald1
Mouse Description:
Kazal-type serine peptidase inhibitor domain 1 Gene [Source:MGI Symbol;Acc:MGI:2147606]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16455 Nonsense Available for shipment Available now
sa41275 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075550 Nonsense 101 296 1 4
Genomic Location:
Chromosome 8 (position 44664474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGCAAACCTGGAGGGCCAGACGTGTGATCCCGGCCAGAGAAGCGTCTA[T/A]TATGGGCTGTGTGGAGMGGACATGGAGTGCAGACCGGACAGGTCGGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075550 Nonsense 102 296 1 4
Genomic Location:
Chromosome 8 (position 44664471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAACCTGGAGGGCCAGACGTGTGATCCCGGCCAGAGAAGCGTCTATTA[T/A]GGGCTGTGTGGAGAGGACATGGAGTGCAGACCGGACAGGTCGGATGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link