cog3

Ensembl ID:
ENSDARG00000053504
ZFIN ID:
ZDB-GENE-050913-26
Description:
conserved oligomeric Golgi complex subunit 3 [Source:RefSeq peptide;Acc:NP_001137512]
Human Orthologue:
COG3
Human Description:
component of oligomeric golgi complex 3 [Source:HGNC Symbol;Acc:18619]
Mouse Orthologue:
Cog3
Mouse Description:
component of oligomeric golgi complex 3 Gene [Source:MGI Symbol;Acc:MGI:2450151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21613 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036994 None None 773 None 23
ENSDART00000122511 None None 194 None 7
ENSDART00000122909 None None 293 None 10
ENSDART00000126948 Nonsense 231 824 6 24
ENSDART00000131605 None None 763 None 22
Genomic Location:
Chromosome 9 (position 55926670)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAAGGATTCGTCCCCATGCTCTCCAAATTAGACGAATGCATAGAATA[T/G]GTTTCATCACATGTAAGTAATCCTGCAGTATTCTCATCGGATGATCTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wcub6so9