cbsa

Ensembl ID:
ENSDARG00000053500
ZFIN ID:
ZDB-GENE-050417-367
Description:
cystathionine-beta-synthase a [Source:RefSeq peptide;Acc:NP_001104702]
Human Orthologue:
CBS
Human Description:
cystathionine-beta-synthase [Source:HGNC Symbol;Acc:1550]
Mouse Orthologue:
Cbs
Mouse Description:
cystathionine beta-synthase Gene [Source:MGI Symbol;Acc:MGI:88285]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10945 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053932 Nonsense 244 571 6 15
ENSDART00000126746 None None 84 5 6

The following transcripts of ENSDARG00000053500 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 28010679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCATATTCTGGACCAATATCGCAATCCCAGCAACCCCCTGGCTCATTA[T/A]GACACCACTGCAGAGGAAATTCTGGAGCAATGTGATGGTAGTTGTTTTANNT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Homocysteine levels: Novel associations of CPS1, MUT, NOX4, and DPEP1 with plasma homocysteine in a healthy population: a genome-wide evaluation of 13 974 participants in the Women's Genome Health Study. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/faud72kw