si:ch211-72k22.4

Ensembl ID:
ENSDARG00000053498
ZFIN ID:
ZDB-GENE-081105-182
Description:
Novel protein similar to vertebrate endothelin receptor type B (EDNRB) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
EDNRB
Human Description:
endothelin receptor type B [Source:HGNC Symbol;Acc:3180]
Mouse Orthologue:
Ednrb
Mouse Description:
endothelin receptor type B Gene [Source:MGI Symbol;Acc:MGI:102720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13240 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075537 Nonsense 163 310 3 6
Genomic Location (Zv9):
Chromosome 9 (position 55838526)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54275046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGGCTGCTCCAGAGGCTGTGGCGTTTGACCAGATCACCATGGATTAY[A/T]GAGGAGAAYRTCTGCGCATCTGCCTGCTTCATCCYGTRCAGAACAATGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link