aldh1a2

Ensembl ID:
ENSDARG00000053493
ZFIN ID:
ZDB-GENE-011010-3
Description:
retinal dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_571925]
Human Orthologue:
ALDH1A2
Human Description:
aldehyde dehydrogenase 1 family, member A2 [Source:HGNC Symbol;Acc:15472]
Mouse Orthologue:
Aldh1a2
Mouse Description:
aldehyde dehydrogenase family 1, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:107928]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16776 Essential Splice Site Available for shipment Available now
sa2367 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa16776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075519 Essential Splice Site 300 518 8 13

The following transcripts of ENSDARG00000053493 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 31670000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGCTCGGGGGAAAGAGTCCCAACATCATTTTTGCAGATGCTGATT[G/A]TAAGTAWTCWGACACTGTTTTACGGCTGGCCTCCTGTTGTCCCGCTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2367
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075519 Essential Splice Site 470 518 11 13

The following transcripts of ENSDARG00000053493 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 31666864)
KASP Assay ID:
554-2940.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGCAAGGCCATGACCATCTCTGCAGCAGTGCAGGCYGGCACCGTCTG[G/A]TAAGACAAAAACTTACACAAAAGTCACAAAAAAKATRGATAGCCAAATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: A genome-wide association study of hypertension and blood pressure in African Americans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6oowv6e4