LOC100333120

Ensembl ID:
ENSDARG00000053488
Human Orthologue:
ITPKB
Human Description:
inositol 1,4,5-trisphosphate 3-kinase B [Source:HGNC Symbol;Acc:6179]
Mouse Orthologue:
Itpkb
Mouse Description:
inositol 1,4,5-trisphosphate 3-kinase B Gene [Source:MGI Symbol;Acc:MGI:109235]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6337 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075525 Essential Splice Site 28 292 2 6
ENSDART00000114935 Essential Splice Site 38 278 3 6
Genomic Location:
Chromosome 14 (position 6191306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTGCAACATYCATTGACATACAATGCATTTTGCATGCTCTGTCTA[G/T]GTAATGTGAGGCTGAGTGAGGGCGGGGAGGTGCTGAAGAGGTTTTGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3hujrscf