LOC556849

Ensembl ID:
ENSDARG00000053481
Human Orthologue:
ENTPD5
Human Description:
ectonucleoside triphosphate diphosphohydrolase 5 [Source:HGNC Symbol;Acc:3367]
Mouse Orthologue:
Entpd5
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 5 Gene [Source:MGI Symbol;Acc:MGI:1321385]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23171 Nonsense Mutation detected in F1 DNA During 2014
sa7841 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075514 Nonsense 105 450 2 13
Genomic Location:
Chromosome 17 (position 45205489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTCTGTGTCCCACAGTTGAGCTTCCAGTGCTTGACAATGAGATGTA[C/A]CATGCAGTGAAGCCCGGACTGTCAGCATATGCAGATATGCCTGAAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075514 Essential Splice Site 169 450 3 13
Genomic Location:
Chromosome 17 (position 45204814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCTTGCGCCTGCTGCCTGAAGAGAAAGCCAAAGCCCTGCTGARTGAG[G/A]TAAGGCTTCCTCTCTTTCTCAGACAATTTGGTAGAGAARCCAACCATYCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9toe6tug