LOC556849

Ensembl ID:
ENSDARG00000053481
Human Orthologue:
ENTPD5
Human Description:
ectonucleoside triphosphate diphosphohydrolase 5 [Source:HGNC Symbol;Acc:3367]
Mouse Orthologue:
Entpd5
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 5 Gene [Source:MGI Symbol;Acc:MGI:1321385]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23171 Nonsense Mutation detected in F1 DNA During 2016
sa7841 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42994 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075514 Nonsense 105 450 2 13
Genomic Location:
Chromosome 17 (position 45205489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTCTGTGTCCCACAGTTGAGCTTCCAGTGCTTGACAATGAGATGTA[C/A]CATGCAGTGAAGCCCGGACTGTCAGCATATGCAGATATGCCTGAAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075514 Essential Splice Site 169 450 3 13
Genomic Location:
Chromosome 17 (position 45204814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCTTGCGCCTGCTGCCTGAAGAGAAAGCCAAAGCCCTGCTGARTGAG[G/A]TAAGGCTTCCTCTCTTTCTCAGACAATTTGGTAGAGAARCCAACCATYCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075514 Nonsense 331 450 10 13
Genomic Location:
Chromosome 17 (position 45201171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTTCTAGGTTATGCAGGGTATAAACTGTGCTACCAAGAGGTGCTG[C/T]AGGTGGTGAAAGGGATTGTGCATCAGCCATTTGAGGTCAAAGGAAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link