gdf6a

Ensembl ID:
ENSDARG00000053479
ZFIN ID:
ZDB-GENE-980526-373
Description:
Growth/differentiation factor 6-A [Source:UniProtKB/Swiss-Prot;Acc:P85857]
Human Orthologue:
GDF6
Human Description:
growth differentiation factor 6 [Source:HGNC Symbol;Acc:4221]
Mouse Orthologue:
Gdf6
Mouse Description:
growth differentiation factor 6 Gene [Source:MGI Symbol;Acc:MGI:95689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42788 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075517 Nonsense 189 404 2 2
Genomic Location (Zv9):
Chromosome 16 (position 41794031)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39177513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTGGCCTCCAGGTCCATTGATCTTCAGGATTCCCGAAAAGCAGAATG[G/A]GAGGTTCTGGACGTTTGGGGGATTTTTAAACACAGGCACCAAGAGAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link