lipc

Ensembl ID:
ENSDARG00000053476
ZFIN ID:
ZDB-GENE-040426-1361
Description:
hepatic triacylglycerol lipase [Source:RefSeq peptide;Acc:NP_957316]
Human Orthologue:
LIPC
Human Description:
lipase, hepatic [Source:HGNC Symbol;Acc:6619]
Mouse Orthologue:
Lipc
Mouse Description:
lipase, hepatic Gene [Source:MGI Symbol;Acc:MGI:96216]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12401 Nonsense Available for shipment Available now
sa20975 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075508 Nonsense 24 514 1 9
ENSDART00000129385 Nonsense 24 514 2 10

The following transcripts of ENSDARG00000053476 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 31729341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTCTYGTGCTTTCTGATGATCTCACAGCTCACTGATGGAGCAAYGTTT[C/T]AGGGAAATCGAGCAGGTGAGGGTCAATTACACTTGTCTTAAAGGGMTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075508 Nonsense 118 514 3 9
ENSDART00000129385 Nonsense 118 514 4 10

The following transcripts of ENSDARG00000053476 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 31733423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGCACTGAAGAGCTCAGAGGGAAACATCAATGTGCTGATTGCAGATT[G/A]GCTGACTCTGGCACACCAGCACTATCCTATAGCAGCGCAGAACACACGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1dymmnvr