adam10a

Ensembl ID:
ENSDARG00000053468
ZFIN ID:
ZDB-GENE-040917-2
Description:
disintegrin and metalloproteinase domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_001152
Human Orthologue:
ADAM10
Human Description:
ADAM metallopeptidase domain 10 [Source:HGNC Symbol;Acc:188]
Mouse Orthologue:
Adam10
Mouse Description:
a disintegrin and metallopeptidase domain 10 Gene [Source:MGI Symbol;Acc:MGI:109548]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12400 Nonsense Available for shipment Available now
sa18489 Nonsense Available for shipment Available now
sa18021 Essential Splice Site Available for shipment Available now
sa17467 Nonsense Available for shipment Available now
sa1909 Nonsense Available for shipment Available now
sa7067 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099639 Nonsense 29 690 1 14
ENSDART00000122259 Nonsense 101 763 3 16
ENSDART00000128654 Nonsense 95 751 6 19
Genomic Location:
Chromosome 7 (position 31778731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCACTCATAATCTGAAGGTGGAAGTTTCAGGTGTAGAGGTCCCCTA[T/A]GACACCTCTCACATTTACACTGGAGAAATATACGGTAGGCTTGGGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099639 Nonsense 185 690 5 14
ENSDART00000122259 Nonsense 258 763 7 16
ENSDART00000128654 Nonsense 252 751 10 19
Genomic Location:
Chromosome 7 (position 31761854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTATGTTTATAGGGTTGTTTTTNGTGCTATCCAGATTTCCAGTCATGTG[A/T]AGGCGATTAACTCCATCTATCAAGGCACAGAKTTTCAGGGCATTMGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099639 Essential Splice Site 326 690 7 14
ENSDART00000122259 Essential Splice Site 399 763 9 16
ENSDART00000128654 Essential Splice Site 393 751 12 19
Genomic Location:
Chromosome 7 (position 31754448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCACATCACCTTCGCTCATGAAGTCGGACATAACTTCGGCTCTCCGG[T/G]GAGTYCTTTTCACTATATGTGCTGCATCCTAGACACATTAGYCGTAAASA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099639 Nonsense 455 690 10 14
ENSDART00000122259 Nonsense 528 763 12 16
ENSDART00000128654 Nonsense 516 751 15 19
Genomic Location:
Chromosome 7 (position 31751956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTTTTCTTTTGCAGTCCCAGTCAGGGTCCATGCTGCACACCACAGTG[C/A]ACGTATAGGACCGGTAAKGAATGTAGGCCGGAATCAGACTGTGCATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099639 Nonsense 475 690 10 14
ENSDART00000122259 Nonsense 548 763 12 16
ENSDART00000128654 Nonsense 536 751 15 19
Genomic Location:
Chromosome 7 (position 31751896)
KASP Assay ID:
554-1899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGTAATGAATGTAGGCCGGAATCAGACTGTGCATTTAAGGGCTTGTG[C/A]AATGGACTCTCTGCCCAATGCCCTGCCTCAACACCCAAAGAAAACTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099639 Nonsense 683 690 14 14
ENSDART00000122259 Nonsense 756 763 16 16
ENSDART00000128654 Nonsense 744 751 19 19
Genomic Location:
Chromosome 7 (position 31747680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTGCACAGACGCAACCACAGCGCCCGCGCCARCAGAGAGAGAACTA[T/A]CAGATGGGACAAATGCGACGCTGAGGCAGCTTCCTCATTGCCTTGGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r79ugczn