gtpbp1

Ensembl ID:
ENSDARG00000053467
ZFIN ID:
ZDB-GENE-030909-12
Description:
GTP-binding protein 1 [Source:RefSeq peptide;Acc:NP_998640]
Human Orthologue:
GTPBP1
Human Description:
GTP binding protein 1 [Source:HGNC Symbol;Acc:4669]
Mouse Orthologue:
Gtpbp1
Mouse Description:
GTP binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109443]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10030 Nonsense Available for shipment Available now
sa33222 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075501 Nonsense 118 642 3 12
ENSDART00000146005 Nonsense 133 657 3 12
Genomic Location:
Chromosome 3 (position 33578205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCACAGTGAGGTCYATGTGTGAGCAGATYGAGGCGGACCTCATCTTGT[T/A]GAGAGAGCGCACTGAGGCTGGCGGCCAGGTCAGAGATTATCTGATTCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075501 Essential Splice Site 497 642 9 12
ENSDART00000146005 Essential Splice Site 512 657 9 12
Genomic Location:
Chromosome 3 (position 33586103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTTTTACATCACCCGACAACCATCTCACCTAGATATCAAGCAATGGG[T/C]GAGAGATATGCTCACCCTTGATAACTGTTGAATGCAAATATGTGAGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link