ENSDARG00000053454

Ensembl ID:
ENSDARG00000053454
Human Orthologues:
CNTN1, CNTN2, CNTN5
Human Descriptions:
contactin 1 [Source:HGNC Symbol;Acc:2171]
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
contactin 5 [Source:HGNC Symbol;Acc:2175]
Mouse Orthologues:
Cntn1, Cntn2, Cntn5
Mouse Descriptions:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]
contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9424 Essential Splice Site Available for shipment Available now
sa2281 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa9424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Essential Splice Site 260 1029 7 22
Genomic Location:
Chromosome 6 (position 44583409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAAGTTTGACATYGATAACTAATTGTGGCCTTGTTCTGYTTAAAAC[A/T]GTCCAGTTCCTAGGATCAGCTGGAGAAGAACCAGTGACGTTTCMTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2281
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 865 1029 19 22
Genomic Location:
Chromosome 6 (position 44532199)
KASP Assay ID:
554-2436.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGACACCAAGCCGGATACAGTGGGTAAAGTTCGAATCACTGGAAACTA[C/A]ACAGCAGTGAATGTCAGCGGCCTGCAGGGGAACACTCAATATTACCTRGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pc2j463f