ENSDARG00000053454

Ensembl ID:
ENSDARG00000053454
Human Orthologues:
CNTN1, CNTN2, CNTN5
Human Descriptions:
contactin 1 [Source:HGNC Symbol;Acc:2171]
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
contactin 5 [Source:HGNC Symbol;Acc:2175]
Mouse Orthologues:
Cntn1, Cntn2, Cntn5
Mouse Descriptions:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]
contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26814 Nonsense Mutation detected in F1 DNA During 2015
sa9424 Essential Splice Site Available for shipment Available now
sa2281 Nonsense F2 line generated During 2015

Mutation Details

Allele Name:
sa26814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 247 1029 6 22
Genomic Location:
Chromosome 6 (position 44586098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACGAGCCTAAAATAGAGCTTCATTTCCCCGACACCATTCCAGCTGCT[A/T]AAGGATCCGCGCTGAAGCTCGAATGCTTCGCCTTGGGAAAGTAAGTCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Essential Splice Site 260 1029 7 22
Genomic Location:
Chromosome 6 (position 44583409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAAGTTTGACATYGATAACTAATTGTGGCCTTGTTCTGYTTAAAAC[A/T]GTCCAGTTCCTAGGATCAGCTGGAGAAGAACCAGTGACGTTTCMTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2281
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 865 1029 19 22
Genomic Location:
Chromosome 6 (position 44532199)
KASP Assay ID:
554-2436.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGACACCAAGCCGGATACAGTGGGTAAAGTTCGAATCACTGGAAACTA[C/A]ACAGCAGTGAATGTCAGCGGCCTGCAGGGGAACACTCAATATTACCTRGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pc2j463f