mpp2a

Ensembl ID:
ENSDARG00000053453
ZFIN ID:
ZDB-GENE-071004-82
Description:
membrane protein, palmitoylated 2a (MAGUK p55 subfamily member 2a) [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
MPP2
Human Description:
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) [Source:HGNC Symbol;Acc:7220]
Mouse Orthologue:
Mpp2
Mouse Description:
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) Gene [Source:MGI Symbol;Acc:MGI:185

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40103 Nonsense Mutation detected in F1 DNA During 2016
sa20059 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059262   None 340 None 10
ENSDART00000103161 Nonsense 107 315 7 21
ENSDART00000121887   None 537 None 14
Genomic Location (Zv9):
Chromosome 3 (position 33499908)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33232493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTACATTGTTTCAAGCTGTCTTCAAACTATCTTCTTTTGTGTTCAAA[C/T]AGGTTTGTGAAGGAATGATGACATAAATTTCAGTTTTGAGTGAACAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059262 Nonsense 324 340 10 10
ENSDART00000103161   None 315 21 21
ENSDART00000121887 Nonsense 521 537 14 14
Genomic Location (Zv9):
Chromosome 3 (position 33512814)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33246974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGTAAACGATGATTTGGAAGAGGCCTACAGTACACTCAAATCCTCCT[T/A]GGAGAAGTTAAAGGGGGTTCAGCAGTGGGTTCCGGTCGGGTGGGTCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link