mpp2a

Ensembl ID:
ENSDARG00000053453
ZFIN ID:
ZDB-GENE-071004-82
Description:
membrane protein, palmitoylated 2a (MAGUK p55 subfamily member 2a) [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
MPP2
Human Description:
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) [Source:HGNC Symbol;Acc:7220]
Mouse Orthologue:
Mpp2
Mouse Description:
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) Gene [Source:MGI Symbol;Acc:MGI:185

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20059 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059262 Nonsense 324 340 10 10
ENSDART00000103161 None None 315 21 21
ENSDART00000121887 Nonsense 521 537 14 14
Genomic Location:
Chromosome 3 (position 33512814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGTAAACGATGATTTGGAAGAGGCCTACAGTACACTCAAATCCTCCT[T/A]GGAGAAGTTAAAGGGGGTTCAGCAGTGGGTTCCGGTCGGGTGGGTCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4lmfum88