pop5

Ensembl ID:
ENSDARG00000053452
ZFIN ID:
ZDB-GENE-050320-123
Description:
Ribonuclease P/MRP protein subunit POP5 [Source:UniProtKB/Swiss-Prot;Acc:Q5BJI6]
Human Orthologue:
POP5
Human Description:
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) [Source:HGNC Symbol;Acc:17689]
Mouse Orthologue:
Pop5
Mouse Description:
processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34463 Nonsense Mutation detected in F1 DNA During 2017
sa41272 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075491 Nonsense 9 169 2 5
Genomic Location (Zv9):
Chromosome 8 (position 43317916)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41271488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTTTAGATGCTTAACAGTTTAAACATGTTACTGTTTTACCAGGTATT[T/A]GCTGTGCGAGCTGTGTGTCTCTGAACCCAGCAGTCTTCATCTTTTCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075491 Essential Splice Site 57 169 3 5
Genomic Location (Zv9):
Chromosome 8 (position 43317649)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41271221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAATTTGTTTAGCTCAGTTTATTTAATATCTTCCTTAATGTTGTGCA[G/A]TGAAATATCTGAATGCCCACACTGGGGTGGTGCTGATCCGCTGCAGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link