si:ch211-251f6.4

Ensembl ID:
ENSDARG00000053443
ZFIN ID:
ZDB-GENE-091204-90
Human Orthologue:
PSTPIP2
Human Description:
proline-serine-threonine phosphatase interacting protein 2 [Source:HGNC Symbol;Acc:9581]
Mouse Orthologue:
Pstpip2
Mouse Description:
proline-serine-threonine phosphatase-interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1335088]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18976 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6160 Nonsense Mutation detected in F1 DNA During 2017
sa21655 Essential Splice Site Available for shipment Available now
sa21656 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Essential Splice Site 117 206 5 8
ENSDART00000138875 Essential Splice Site 129 198 5 8
Genomic Location (Zv9):
Chromosome 10 (position 7135475)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8148275
KASP Assay ID:
2261-7167.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAAATTAGAAGACTTCAGAGAGAAACAGAAAGAGGCCCGGAAAAAGG[T/C]AAGAGCATTTCATACCTTTTTAATTGATTTAAAGTGTGTTATTTGTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Nonsense 145 206 7 8
ENSDART00000138875 Nonsense 157 198 7 8
Genomic Location (Zv9):
Chromosome 10 (position 7155614)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8168414
KASP Assay ID:
554-4752.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTTAAAATGTCAGTCATTGTCTTTTAAGGCAAAGAAGAGCTACGAT[C/T]AAAAATGCAGAGACAAAGAGGAAACAGAGCAGAACATGAACAGAAGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
Genomic Location (Zv9):
Chromosome 10 (position 7155695)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8168495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACATGAACAGAAGTGCCACCACTTGCAGTGCCAAGCAGCAAGAAAAG[G/T]TACATAAATATAACTGTGAGAAAGAATCATGCTTTCTTTTAAATTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
Genomic Location (Zv9):
Chromosome 10 (position 7155695)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8168495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACATGAACAGAAGTGCCACCACTTGCAGTGCCAAGCAGCAAGAAAAG[G/T]TACATAAATATAACTGTGAGAAAGAATCATGCTTTCTTTTAAATTTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link