h2afy

Ensembl ID:
ENSDARG00000053442
ZFIN IDs:
ZDB-GENE-060421-4796, ZDB-GENE-060421-4796
Description:
H2A histone family, member Y [Source:RefSeq peptide;Acc:NP_001035451]
Human Orthologue:
H2AFY
Human Description:
H2A histone family, member Y [Source:HGNC Symbol;Acc:4740]
Mouse Orthologue:
H2afy
Mouse Description:
H2A histone family, member Y Gene [Source:MGI Symbol;Acc:MGI:1349392]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14475 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088826 Splice Site, Nonsense 94 357 4 9
ENSDART00000124761 Splice Site, Nonsense 94 357 3 9
Genomic Location:
Chromosome 21 (position 44402271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCTTACTGAGRTYTTCCTCTTCAGAWGTCTGTGTTTGTGTGTGCAGT[T/A]GCTGCGGGGCGTCACCATCTCCGCTGGGGGGGTTCTACCCAAYATCCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eonuxnc0