LOC100000526

Ensembl ID:
ENSDARG00000053439
Human Orthologue:
SEC24A
Human Description:
SEC24 family, member A (S. cerevisiae) [Source:HGNC Symbol;Acc:10703]
Mouse Orthologue:
Sec24a
Mouse Description:
Sec24 related gene family, member A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1924621]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14962 Nonsense Available for shipment Available now
sa37388 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37389 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099278 Nonsense 923 1097 18 40
Genomic Location:
Chromosome 21 (position 44346609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCGTCCTGCTGCTCCTCCAGAAAGCGTTCGGCACGAGCAGCGCCACA[C/T]GACTGGACGAGCGCATGTTCTGCATGTGTCARCTGAAGCAGCAGCCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099278 Essential Splice Site None 1097 None 40

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 44367502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTGGGCGGACGGAGCGTGGTGTGTTCAGATGTGGAGCAGCATGTGG[T/G]GAGGGAGCACACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099278 Essential Splice Site None 1097 None 40

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 44370243)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGCGCTCGGCCTGCACGACTCTGATGATGAGGACACCGCGCTCGACG[T/C]GAGTCTCCGTGTGTGTGTGTGTGTGTGTGTGTGGCACTGTCTGTATAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link