KIFC2

Ensembl ID:
ENSDARG00000053431
Description:
kinesin family member C2 [Source:HGNC Symbol;Acc:29530]
Human Orthologue:
KIFC2
Human Description:
kinesin family member C2 [Source:HGNC Symbol;Acc:29530]
Mouse Orthologue:
Kifc2
Mouse Description:
kinesin family member C2 Gene [Source:MGI Symbol;Acc:MGI:109187]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2867 Essential Splice Site F2 line generated During 2014
sa5620 Essential Splice Site F2 line generated During 2014
sa10867 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2867
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059841 Essential Splice Site 20 558 2 13
ENSDART00000059841 Essential Splice Site 20 558 2 13
Genomic Location:
Chromosome 16 (position 18619025)
KASP Assay ID:
554-3142.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACGAGGGCAGAARATATCAGGAGACGAGAGGAGAGAGTGAGAGAGCT[G/C]CAGCTGCAACTGGACAAAGAACGCAACAAGGAGCCTGTGGTTAAAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5620
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059841 Essential Splice Site 20 558 2 13
ENSDART00000059841 Essential Splice Site 20 558 2 13
Genomic Location:
Chromosome 16 (position 18619025)
KASP Assay ID:
554-3142.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACGAGGGCAGAARATATCAGGAGACGAGAGGAGAGAGTGAGAGAGCT[G/C]CAGCTGCAACTGGACAAAGAACGCAACAAGGAGCCTGTGGTTAAAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059841 Nonsense 461 558 12 13
Genomic Location:
Chromosome 16 (position 18609076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGGSAAGCTGAATCTGGTRGAYCTGGCTGGTTCTGAGAGGGTGTGG[A/T]AGTCTGGAGCAGAGGGGGAGAGACTGAAGGAAGCCCAGAATATTAATCRC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/it23s7tt