LOC569359

Ensembl ID:: ENSDARG00000053389
Human Orthologue:: PHF15
Human Description:: PHD finger protein 15 [Source:HGNC Symbol;Acc:22984]
Mouse Orthologue:: Phf15
Mouse Description:: PHD finger protein 15 Gene [Source:MGI Symbol;Acc:MGI:1924151]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa4971	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa4971
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000075432	Nonsense	82	795	3	11

Genomic Location:: Chromosome 21 (position 44074177)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CAGCACAGCTGAGCGCAGACGAGTTCTACATTCTGTGCGACCCCTGGAGG[C/T]AGGAGTGGGAGAAGGGCGTTCAGGTGCCAGCCAACGTGGAGACCATTCCT
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for PHF15

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: