eif3jb

Ensembl ID:
ENSDARG00000053370
ZFIN ID:
ZDB-GENE-040426-2900
Description:
Eukaryotic translation initiation factor 3 subunit J-B [Source:UniProtKB/Swiss-Prot;Acc:Q803P1]
Human Orthologue:
EIF3J
Human Description:
eukaryotic translation initiation factor 3, subunit J [Source:HGNC Symbol;Acc:3270]
Mouse Orthologues:
Eif3j, Gm9781
Mouse Descriptions:
eukaryotic translation initiation factor 3, subunit J Gene [Source:MGI Symbol;Acc:MGI:1925905]
predicted gene 9781 Gene [Source:MGI Symbol;Acc:MGI:3704486]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40927 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38619 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075400 Essential Splice Site 130 264 None 8

The following transcripts of ENSDARG00000053370 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 32763256)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31157596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATATATATATATGTATAAAGTTAATCGATGAATTTCTTCCCGTCTTT[A/G]GGTGTGGATCCTGCTGCTGCAAATGCCTCAACTACTGTTAACACAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075400 Nonsense 260 264 8 8

The following transcripts of ENSDARG00000053370 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 32765684)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31160024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACTTTGCTGACTATGGTGGTTTTGACGGTGGTTACGGCAATGAATA[T/A]GATGACTTCATGTGACAAAGGATCATCGTTCCCCTTCCCATTCCCTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link