eif3jb

Ensembl ID:
ENSDARG00000053370
ZFIN ID:
ZDB-GENE-040426-2900
Description:
Eukaryotic translation initiation factor 3 subunit J-B [Source:UniProtKB/Swiss-Prot;Acc:Q803P1]
Human Orthologue:
EIF3J
Human Description:
eukaryotic translation initiation factor 3, subunit J [Source:HGNC Symbol;Acc:3270]
Mouse Orthologues:
Eif3j, Gm9781
Mouse Descriptions:
eukaryotic translation initiation factor 3, subunit J Gene [Source:MGI Symbol;Acc:MGI:1925905]
predicted gene 9781 Gene [Source:MGI Symbol;Acc:MGI:3704486]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40927 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8271 Nonsense Mutation detected in F1 DNA During 2016
sa38619 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075400 Essential Splice Site 130 264 None 8

The following transcripts of ENSDARG00000053370 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 32763256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATATATATATATGTATAAAGTTAATCGATGAATTTCTTCCCGTCTTT[A/G]GGTGTGGATCCTGCTGCTGCAAATGCCTCAACTACTGTTAACACAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075400 Nonsense 139 264 6 8

The following transcripts of ENSDARG00000053370 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 32763285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAATTTCTTCCYGTCTTTAGGTGTGGATCCTGCTGCTGCAAATGCCT[C/A]AACTACTGTTAACACAACAAAYGCCTCTGGAATTGAAGCCATGTGCCCKT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075400 Nonsense 260 264 8 8

The following transcripts of ENSDARG00000053370 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 32765684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACTTTGCTGACTATGGTGGTTTTGACGGTGGTTACGGCAATGAATA[T/A]GATGACTTCATGTGACAAAGGATCATCGTTCCCCTTCCCATTCCCTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link