ftr12

Ensembl ID:
ENSDARG00000053366
ZFIN ID:
ZDB-GENE-070912-196
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S539]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19847 Nonsense Mutation detected in F1 DNA During 2016
sa15836 Nonsense Available for shipment Available now
sa39910 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Nonsense 136 547 1 6
ENSDART00000143419 Nonsense 136 291 1 3
Genomic Location:
Chromosome 2 (position 42817518)
KASP Assay ID:
2259-2505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAACTCTTACTGCCAAAATCATCTTGAACAACACGAGAGTTTCTTC[A/T]GAGGTAAAAGACACAATCTGATGGACGCCACTGGACGACTGCAGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Nonsense 214 547 2 6
ENSDART00000143419 Nonsense 214 291 2 3
Genomic Location:
Chromosome 2 (position 42817884)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTCAGTTGGCTGAGATGCNARAAAACAACCCATCAGCRAATCGAGGRG[A/T]AACAAAAGGAGTGTGWGGAGCTGAGAGAGGCTGTTGAGTCTYACAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Essential Splice Site 380 547 5 6
ENSDART00000143419   None 291 None 3
Genomic Location:
Chromosome 2 (position 42819336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACATAATTCCCACCTCTGAGCCAGAGACAATTGAGCAGTTCCAACAAT[G/T]TAAGTCTTTATCTCGAAATATAGAAACCTACATGCAATAGCTCTGGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link