Q5BLC3_DANRE

Ensembl ID:
ENSDARG00000053362
Description:
CILP protein [Source:UniProtKB/TrEMBL;Acc:Q5BLC3]
Human Orthologue:
CILP
Human Description:
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase [Source:HGNC Symbol;Acc:1980]
Mouse Orthologue:
Cilp
Mouse Description:
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40928 Nonsense Mutation detected in F1 DNA During 2017
sa7599 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075398 Nonsense 71 1171 3 8
Genomic Location (Zv9):
Chromosome 7 (position 32772084)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31166424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCACCCTGGTGGGAAAGGAGATTATGAGAAGCTGAATGTAATTCGTTA[T/G]TATTATCGAGCCCGTGTGTGTGAGGTTCCTCGAGCTCTGGAGGCACGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075398 Missense 244 1171 5 8
Genomic Location (Zv9):
Chromosome 7 (position 32770276)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31164616
KASP Assay ID:
554-4256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTGCACCTGGAGCTGCAATCCTGCGTGCTGGWTCCAGCMCCAAACTC[C/T]TCACTGTTACTGATCAYAATGGACACTTCCAAGTCCCTGGAATCTGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link