gpr133

Ensembl ID:
ENSDARG00000053344
ZFIN ID:
ZDB-GENE-041212-24
Description:
G protein-coupled receptor 133Novel protein similar to H.sapiens GPR133, G protein-coupled receptor
Human Orthologue:
GPR133
Human Description:
G protein-coupled receptor 133 [Source:HGNC Symbol;Acc:19893]
Mouse Orthologue:
Gpr133
Mouse Description:
G protein-coupled receptor 133 Gene [Source:MGI Symbol;Acc:MGI:3041203]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41283 Nonsense Mutation detected in F1 DNA During 2017
sa34472 Nonsense Mutation detected in F1 DNA During 2017
sa31670 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075372   None 240 None 8
ENSDART00000110688 Nonsense 128 485 5 12
ENSDART00000134073   None 240 None 9
ENSDART00000146152 Nonsense 27 186 1 3
ENSDART00000148358   None 359 None 11
Genomic Location (Zv9):
Chromosome 8 (position 46213199)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43930290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTATCTGAACGGCGATAACGGGGCCACTTTCCTTCACTTTGGCAACTA[T/G]AAGGACTCCTGCATTAGTGATCCTACTCTCTGCGGACCTGCTGGTGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075372   None 240 None 8
ENSDART00000110688 Nonsense 164 485 6 12
ENSDART00000134073   None 240 None 9
ENSDART00000146152 Nonsense 63 186 2 3
ENSDART00000148358   None 359 None 11
Genomic Location (Zv9):
Chromosome 8 (position 46214152)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43929337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCTTCTGGAAAAACAATGACGACGAGTCTCGTTTTGCGATCGCATCC[G/T]GAGGTAAAGTCATCTCAAGCGGTTTCTCAGTCTACTCAAATCCTTATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075372 Essential Splice Site 178 240 6 8
ENSDART00000110688   None 485 None 12
ENSDART00000134073 Essential Splice Site 178 240 7 9
ENSDART00000146152   None 186 None 3
ENSDART00000148358 Essential Splice Site 297 359 9 11
Genomic Location (Zv9):
Chromosome 8 (position 46314126)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43829363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAAGGGGTTCTTCATATTCCTGTTTCACTGTCTGTTAAACTCTGAGG[T/C]AAGTGTGTGTTTGTGCAGCTGTGACTGAAGTCTGTGCTGTGTATCTGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link