lrrc6

Ensembl ID:
ENSDARG00000053318
ZFIN ID:
ZDB-GENE-040827-2
Description:
leucine-rich repeat-containing protein 6 [Source:RefSeq peptide;Acc:NP_001002311]
Human Orthologue:
LRRC6
Human Description:
leucine rich repeat containing 6 [Source:HGNC Symbol;Acc:16725]
Mouse Orthologue:
Lrrc6
Mouse Description:
leucine rich repeat containing 6 (testis) Gene [Source:MGI Symbol;Acc:MGI:1859553]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39914 Nonsense Mutation detected in F1 DNA During 2016
sa19850 Nonsense Mutation detected in F1 DNA During 2016
sa14388 Essential Splice Site Available for shipment Available now
sa19849 Nonsense Mutation detected in F1 DNA During 2016
sa14481 Nonsense Available for shipment Available now
sa25885 Nonsense Mutation detected in F1 DNA During 2016
sa19848 Nonsense Mutation detected in F1 DNA During 2016
sa33003 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 34 440 2 12
ENSDART00000132346 Nonsense 34 440 3 13
Genomic Location (Zv9):
Chromosome 2 (position 43224653)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43274117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGATCTTCTCCCTTGAGGAGCTTTCCCTTCATCAGCAGGACATC[C/T]AGAGAATCGAGCACATCCACAAGTGGTGCAGAGACCTCAAAATCCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 50 440 2 12
ENSDART00000132346 Nonsense 50 440 3 13
Genomic Location (Zv9):
Chromosome 2 (position 43224603)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43274067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAATCGAGCACATCCACAAGTGGTGCAGAGACCTCAAAATCCTTTA[T/A]TTACAAAACAACCTCATCCCTAAAATAGGTAAATACTGGACAGTGGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Essential Splice Site 60 440 2 12
ENSDART00000132346 Essential Splice Site 60 440 3 13
Genomic Location (Zv9):
Chromosome 2 (position 43224573)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43274037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGACCTCAAAATCCTTTATTTACAAAACAACCTCATCCCTAAAATAGG[T/G]AAATACTGGACNNNNNNNNTGTGGTATTGYAGCAACYCAAACGCATGGYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 69 440 3 12
ENSDART00000132346 Nonsense 69 440 4 13
Genomic Location (Zv9):
Chromosome 2 (position 43224462)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43273926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTTGTAACTTTGTTTTTGCAGAAAATGTCGGCAGGCTAAAGAAGCTG[G/T]AATATTTAAATCTGGCACTGAACAACATTGAGGTCATTGAGAATTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 84 440 3 12
ENSDART00000132346 Nonsense 84 440 4 13
Genomic Location (Zv9):
Chromosome 2 (position 43224416)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43273880
KASP Assay ID:
2259-2512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAATATTTAAATCTGGCACTGAACAACATTGAGGTCATTGAGAATT[T/A]GGAAGGTGACTTCATACAGTGTGTNNNNNNGTGTGTGTGTNNNNNNNNNNGTNNNNNNNNNNNNGTAACTGGGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 90 440 4 12
ENSDART00000132346 Nonsense 90 440 5 13
Genomic Location (Zv9):
Chromosome 2 (position 43221748)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43271212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATTACAAACTCTAATATACGTTTGGTTGTGCGTAGGTTGCGAGAGCT[T/A]ACAGAAACTAGACCTGACAGTGAATTTTGTGGGTAGGCTGAGCAGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 91 440 4 12
ENSDART00000132346 Nonsense 91 440 5 13
Genomic Location (Zv9):
Chromosome 2 (position 43221746)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43271210
KASP Assay ID:
2259-2510.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTACAAACTCTAATATACGTTTGGTTGTGCGTAGGTTGCGAGAGCTTA[C/T]AGAAACTAGACCTGACAGTGAATTTTGTGGGTAGGCTGAGCAGTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075347 Nonsense 134 440 4 12
ENSDART00000132346 Nonsense 134 440 5 13
Genomic Location (Zv9):
Chromosome 2 (position 43221615)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43271079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTATCTGGTGGGAAACCCCTGTGCTGAATACCACGGGTACAGACAGTA[T/A]GTGGTGGCAACAGTGCCTCAACTACAGGTACAGCACTGATACACACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link