LOC100332312

Ensembl ID:
ENSDARG00000053311
Human Orthologue:
KIAA0748
Human Description:
KIAA0748 [Source:HGNC Symbol;Acc:29109]
Mouse Orthologue:
5830405N20Rik
Mouse Description:
RIKEN cDNA 5830405N20 gene Gene [Source:MGI Symbol;Acc:MGI:1914846]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9579 Splice Site, Nonsense Available for shipment Available now
sa810 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075337 Splice Site, Nonsense 140 585 7 10
Genomic Location:
Chromosome 6 (position 46653993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTAACTTTGCTTTTGTCTTTCATGACATCTCAAAAACCCATCAGTT[T/A]GWCTGAGGTCCTTCAGATGCGTGCAGAAGATGCAGAGGAAACYCTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075337 Nonsense 233 585 8 10
Genomic Location:
Chromosome 6 (position 46654573)
KASP Assay ID:
554-0715.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGACGGCAATGGCGAACGCCTTCTACTCGTTGTACTCCCATGTGTCC[C/T]GAACACCACTCCAAAAGCTCGCACCGCCCCAGTTAACCTTCACCTCCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qohq01o8