LOC100332312

Ensembl ID:
ENSDARG00000053311
Human Orthologue:
KIAA0748
Human Description:
KIAA0748 [Source:HGNC Symbol;Acc:29109]
Mouse Orthologue:
5830405N20Rik
Mouse Description:
RIKEN cDNA 5830405N20 gene Gene [Source:MGI Symbol;Acc:MGI:1914846]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33954 Nonsense Mutation detected in F1 DNA During 2016
sa9579 Splice Site, Nonsense Available for shipment Available now
sa810 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075337 Nonsense 54 585 2 10
Genomic Location (Zv9):
Chromosome 6 (position 46643297)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46704231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCACTATGTGCGTCTTTATTTTGTTTCCACAGGATGCTCTGCAGGA[A/T]AGATTGAAAGCTGGCTCCAAGGTTGTGGGTGAGTGTTTGTGGGTCTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075337 Splice Site, Nonsense 140 585 7 10
Genomic Location (Zv9):
Chromosome 6 (position 46653993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46714927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTAACTTTGCTTTTGTCTTTCATGACATCTCAAAAACCCATCAGTT[T/A]GWCTGAGGTCCTTCAGATGCGTGCAGAAGATGCAGAGGAAACYCTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075337 Nonsense 233 585 8 10
Genomic Location (Zv9):
Chromosome 6 (position 46654573)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46715507
KASP Assay ID:
554-0715.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGACGGCAATGGCGAACGCCTTCTACTCGTTGTACTCCCATGTGTCC[C/T]GAACACCACTCCAAAAGCTCGCACCGCCCCAGTTAACCTTCACCTCCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link