map3k4

Ensembl ID:
ENSDARG00000053303
ZFIN IDs:
ZDB-GENE-090313-125, ZDB-GENE-990603-4, ZDB-GENE-990603-4
Description:
Novel protein similar to H.sapiens MAP3K4, mitogen-activated protein kinase kinase kinase 4 (MAP3K4)
Human Orthologue:
MAP3K4
Human Description:
mitogen-activated protein kinase kinase kinase 4 [Source:HGNC Symbol;Acc:6856]
Mouse Orthologue:
Map3k4
Mouse Description:
mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1374 Nonsense Available for shipment Available now
sa11281 Nonsense Available for shipment Available now
sa22347 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 196 1488 3 30
ENSDART00000137256 Nonsense 230 770 3 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 36226524)
KASP Assay ID:
554-1286.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTCGCCGTAGTGTTAATGACCAGGACCTGTACCTGTTYACCGCTCGA[C/T]AACACATACCTGACATYATCAGCGAGGTTTTGCACTTCAAAGTGGACTAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 599 1488 7 30
ENSDART00000137256 Nonsense 659 770 6 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 36219921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCACRCAGGTGTACTTTGACTACATGCGCAGCTGGATCCAGATGTTA[C/T]AGCAGCTTYCTCAAGCRTCCCACAGCCTGAAGAACCTGCTGGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 1224 1488 23 30
ENSDART00000137256 None None 770 None 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 36202868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACGATAACGTGATGCATGTGGGCCTGCGCAAAGTCACCTTTAAATGG[C/T]AGAGAGGAAACAAGATCGGTGAGTGAACAGCAGTGTGCATATGACGAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pk5ez3vd