insm1b

Ensembl ID:
ENSDARG00000053301
ZFIN ID:
ZDB-GENE-030131-2602
Description:
insulinoma-associated 1 [Source:RefSeq peptide;Acc:NP_955952]
Human Orthologue:
INSM1
Human Description:
insulinoma-associated 1 [Source:HGNC Symbol;Acc:6090]
Mouse Orthologue:
Insm1
Mouse Description:
insulinoma-associated 1 Gene [Source:MGI Symbol;Acc:MGI:1859980]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13938 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075331 Nonsense 290 453 1 1
Genomic Location:
Chromosome 17 (position 41580628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACAAACCGCGCGTGCAGAGCGCGCCGAAACAAGCCCTCCAACCCGCC[A/T]AGCCTTTCCCCGAAGAGCTGAGAGCCGAGTTCCCCAGCGACAGAGACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p5o5xjez