nkx2.2a

Ensembl ID:
ENSDARG00000053298
ZFIN ID:
ZDB-GENE-980526-403
Description:
Homeobox protein Nkx-2.2a [Source:UniProtKB/Swiss-Prot;Acc:Q90481]
Human Orthologue:
NKX2-2
Human Description:
NK2 homeobox 2 [Source:HGNC Symbol;Acc:7835]
Mouse Orthologue:
Nkx2-2
Mouse Description:
NK2 transcription factor related, locus 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23158 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081396 Nonsense 210 269 3 3
ENSDART00000140549 Nonsense 214 273 2 2
Genomic Location (Zv9):
Chromosome 17 (position 42936578)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42776637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCCTTCTCCTAGGCGGGTGGCCGTGCCAGTGTTAGTCAGAGACGGC[A/T]AACCTTGCCATACGCTAAAAGCTCAGGACTTGGCAGCTACTTTTCAGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link