RAP1GAP (3 of 3)

Ensembl ID:
ENSDARG00000053272
Description:
RAP1 GTPase activating protein [Source:HGNC Symbol;Acc:9858]
Human Orthologue:
RAP1GAP
Human Description:
RAP1 GTPase activating protein [Source:HGNC Symbol;Acc:9858]
Mouse Orthologue:
Rap1gap
Mouse Description:
Rap1 GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:109338]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33957 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075274 Essential Splice Site 358 631 11 18
Genomic Location (Zv9):
Chromosome 6 (position 47826082)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47886734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGCCTTTTTTTGGTCCAGCTCTGCCAGATCCAGCTGTCTTTAAAAAG[G/A]TACCTATTTTCACTCTGCTTTCATGTCATTTGACCAGCTCCGCATGACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link