itgb1b

Ensembl ID:
ENSDARG00000053255
ZFIN ID:
ZDB-GENE-030909-10
Description:
integrin, beta 1b [Source:RefSeq peptide;Acc:NP_001030159]
Human Orthologue:
ITGB1
Human Description:
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) [Source
Mouse Orthologue:
Itgb1
Mouse Description:
integrin beta 1 (fibronectin receptor beta) Gene [Source:MGI Symbol;Acc:MGI:96610]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39928 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075261 Splice Site, Nonsense 52 516 1 9
Genomic Location (Zv9):
Chromosome 2 (position 46102298)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149986.1 7057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGGAAATGCCATCTGCAGGATAACATTTACACCATGAGCCATTACTA[T/A]GTAAGTGTGTGTGTTACACCGTGATTGATTACTTTGCTGTGTGCCTCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link