mylz2

Ensembl ID:
ENSDARG00000053254
ZFIN ID:
ZDB-GENE-990712-15
Description:
myosin, light polypeptide 2, skeletal muscle [Source:RefSeq peptide;Acc:NP_571263]
Human Orthologue:
MYLPF
Human Description:
myosin light chain, phosphorylatable, fast skeletal muscle [Source:HGNC Symbol;Acc:29824]
Mouse Orthologue:
Mylpf
Mouse Description:
myosin light chain, phosphorylatable, fast skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:97273]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8583 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075465 Essential Splice Site 136 169 6 7
ENSDART00000142582 Essential Splice Site 112 145 5 6
Genomic Location:
Chromosome 3 (position 32952980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTTGAGGAGCTTTTGACCACTCAGTGCGACAGGTTCACCGCAGAGGAG[G/A]TAAGATCAGAGTAAYGTCCTCATGATGAGTGCATGTATTTATCCTATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eqgct3oi