kif6

Ensembl ID:
ENSDARG00000053240
ZFIN IDs:
ZDB-GENE-061027-130, ZDB-GENE-061027-130
Description:
kinesin-like protein KIF6 [Source:RefSeq peptide;Acc:NP_001070899]
Human Orthologue:
KIF6
Human Description:
kinesin family member 6 [Source:HGNC Symbol;Acc:21202]
Mouse Orthologue:
Kif6
Mouse Description:
kinesin family member 6 Gene [Source:MGI Symbol;Acc:MGI:1098238]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36523 Nonsense Mutation detected in F1 DNA During 2017
sa36522 Essential Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa43002 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103662 Nonsense 136 693 5 20
ENSDART00000103663 Nonsense 136 667 5 21
Genomic Location (Zv9):
Chromosome 17 (position 48954785)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48716583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACTGTTCATATTTATATATTTTTTTGCAGAACAACACAATGATTTA[T/G]ACAACCCACATATCTTACCTGGAAATCTACAATGAGTCTGGCTATGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103662 Nonsense 392 693 11 20
ENSDART00000103663 Essential Splice Site 328 667 None 21
Genomic Location (Zv9):
Chromosome 17 (position 48933241)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48695039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTTGTTTTGTAGAAGGACACAGGAGTATTATTCCTGTTTTTTAGGT[T/A]GGAAGGATTGGTGAATGTATATTTGGAGGACCCTGACTGTGAAGTAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103662 Missense 392 693 11 20
ENSDART00000103663 Essential Splice Site 328 667 9 21
Genomic Location (Zv9):
Chromosome 17 (position 48933240)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48695038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGTTTTGTAGAAGGACACAGGAGTATTATTCCTGTTTTTTAGGTT[G/T]GAAGGATTGGTGAATGTATATTTGGAGGACCCTGACTGTGAAGTAACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link